vectorstrip

 

Function

Strips out DNA between a pair of vector sequences

Description

vectorstrip is intended to be useful for stripping vector sequence from the ends of sequences of interest. For example, if a fragment has been cloned into a vector and then sequenced, the sequence may contain vector data eg from the cloning polylinker at the 5' and 3' ends of the sequence. vectorstrip will remove these contaminating regions and output trimmed sequence ready for input into another application.

vectorstrip is suitable for use with low quality sequence data as it can allow for mismatches between the sequence and the vector patterns provided. You can specify the maximum level of mismatch expected.

Vector data can either be provided in a file or interactively. If presented in a file, vectorstrip will search all input sequences with all vectors listed in that file. The intention is that the user can maintain a single file for use with vectorstrip, containing all the linker sequences commonly used in the laboratory.

The two patterns for each vector are searched separately against the sequence. Once the search is completed, each of the hits of the 5' sequence is paired with each of the hits of the 3' sequence and the resulting subsequences are output. For example, if the 5' sequence matches the sequence from (a) position 30-60, and(b)position 70-100, and the 3' sequence matches from 150-175, then two subsequences will be output: from 61-149, and from 101-149. The lower the quality of the sequence, the more likely multiple hits become if nonzero mismatches are accepted.

Default behaviour is to report only the best matches between the vector patterns and the sequence. This means that if you specify a maximum mismatch level of 10%, but the vector patterns match the sequence with zero mismatches, the search will stop and the program will output only these "best" matches. If there are no perfect matches, the program will try searching again allowing 1 mismatch, then 2, and so on until either the patterns match the sequence or the maximum specified mismatch level is exceeded. You can tell vectorstrip to show all possible matches up to your specified maximum level, as illustrated in the examples below.

Usage

Here is a sample session with vectorstrip 


% vectorstrip @vecseqs.list 
Strips out DNA between a pair of vector sequences
Are your vector sequences in a file? [Y]: 
Cloning vector definition file (optional): vectors
Max allowed % mismatch [10]: 
Show only the best hits (minimise mismatches)? [Y]: 
Output file [pbluescript.vectorstrip]: vector.strip
output sequence(s) [pbluescript.fasta]: vector.fasta

Go to the input files for this example
Go to the output files for this example

Command line arguments 

   Standard (Mandatory) qualifiers (* if not always prompted):
  [-sequence]          seqall     Nucleotide sequence(s) filename and optional
                                  format, or reference (input USA)
  [-[no]vectorfile]    toggle     [Y] Are your vector sequences in a file?
*  -vectorsfile        infile     Cloning vector definition file (optional)
   -mismatch           integer    [10] Max allowed % mismatch (Any integer
                                  value)
   -[no]besthits       boolean    [Y] Show only the best hits (minimise
                                  mismatches)?
*  -linkera            string     The 5' sequence (Any string is accepted)
*  -linkerb            string     The 3' sequence (Any string is accepted)
  [-outfile]           outfile    [*.vectorstrip] Output file name
  [-outseq]            seqoutall  [.] Sequence set(s)
                                  filename and optional format (output USA)

   Additional (Optional) qualifiers:
   -allsequences       boolean    [N] Show all sequences in output

   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory3        string     Output directory

   "-outseq" associated qualifiers
   -osformat4          string     Output seq format
   -osextension4       string     File name extension
   -osname4            string     Base file name
   -osdirectory4       string     Output directory
   -osdbname4          string     Database name to add
   -ossingle4          boolean    Separate file for each entry
   -oufo4              string     UFO features
   -offormat4          string     Features format
   -ofname4            string     Features file name
   -ofdirectory4       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Standard (Mandatory) qualifiers Allowed values Default
[-sequence]
(Parameter 1)		 Nucleotide sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
[-[no]vectorfile]
(Parameter 2)		 Are your vector sequences in a file? Toggle value Yes/No Yes
-vectorsfile Cloning vector definition file (optional) Input file Required
-mismatch Max allowed % mismatch Any integer value 10
-[no]besthits Show only the best hits (minimise mismatches)? Boolean value Yes/No Yes
-linkera The 5' sequence Any string is accepted An empty string is accepted
-linkerb The 3' sequence Any string is accepted An empty string is accepted
[-outfile]
(Parameter 3)		 Output file name Output file <*>.vectorstrip
[-outseq]
(Parameter 4)		 Sequence set(s) filename and optional format (output USA) Writeable sequence(s) <*>.format
Additional (Optional) qualifiers Allowed values Default
-allsequences Show all sequences in output Boolean value Yes/No No
Advanced (Unprompted) qualifiers Allowed values Default
(none)

Input file format

Input files for usage example

File: vecseqs.list

../../data/bluescript.seq
../../data/litmus.seq
../../data/pTYB1.seq

File: vectors

# Example vector file for use by vectorstrip

# Vector	5'			3'

pTYB1   GACGGCGGCCGCGAATTCC     TCGAGGGCTCTTCCTGC
pBS_KS+ GGGTACCGGGCCCCCCC       TCGAGGTCGACGGTA         
pLITMUS GATATCCTGCAGGAATTCC     TCGAGACCGTACGTGCG

The same fragment has been cloned into the XhoI site of the polylinker of each vector. The cloned fragment is represented in lower case and the vector sequence in upper case so the sequence trimming can be readily seen.

Each line of the vector file should contain the name of the vector, the 5' pattern and the 3' pattern.
Lines beginning with # are treated as comments and ignored.
If only one vector sequence is given in the it will be assumed that this is the 5' pattern.
If a vector name is given but no pattern data, the vector will not be used.

Output file format

Output files for usage example

File: vector.strip


Sequence: pBlueScript 	 Vector: pTYB1	No match


Sequence: pBlueScript 	 Vector: pBS_KS+
5' sequence matches:
	From 67 to 83 with 0 mismatches
3' sequence matches:
	From 205 to 219 with 0 mismatches
Sequences output to file:
	from 84 to 204
		tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca
		cacagtgacatgagagacacagatatagagacagatagacgatagacaga
		cagcatatatagacagatagc
	sequence trimmed from 5' end:
		GGAAACAGCTAATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACT
		AAAGGGAACAAAAGCTGGGTACCGGGCCCCCCC
	sequence trimmed from 3' end:
		TCGAGGTCGACGGTATCGATAAGCTTGATATCG


Sequence: pBlueScript 	 Vector: pLITMUS	No match

Sequence: litmus.seq 	 Vector: pTYB1	No match

Sequence: litmus.seq 	 Vector: pBS_KS+	No match


Sequence: litmus.seq 	 Vector: pLITMUS
5' sequence matches:
	From 43 to 61 with 0 mismatches
3' sequence matches:
	From 183 to 199 with 0 mismatches
Sequences output to file:
	from 62 to 182
		tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca
		cacagtgacatgagagacacagatatagagacagatagacgatagacaga
		cagcatatatagacagatagc
	sequence trimmed from 5' end:
		TCTAGAACCGGTGACGTCTCCCATGGTGAAGCTTGGATCCACGATATCCT
		GCAGGAATTCC
	sequence trimmed from 3' end:
		TCGAGACCGTACGTGCGCGCGAATGCATCCAGATCTTCCCTCTAGTCAAG
		GCCTTAAGTGAGTCGTATTACGGA



Sequence: pTYB1.seq 	 Vector: pTYB1
5' sequence matches:
	From 40 to 58 with 0 mismatches
3' sequence matches:
	From 180 to 196 with 0 mismatches
Sequences output to file:
	from 59 to 179
		tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca
		cacagtgacatgagagacacagatatagagacagatagacgatagacaga
		cagcatatatagacagatagc
	sequence trimmed from 5' end:
		CTTTAAGAAGGAGATATACATATGGCTAGCTCGCGAGTCGACGGCGGCCG
		CGAATTCC
	sequence trimmed from 3' end:
		TCGAGGGCTCTTCCTGCTTTGCCAAGGGTACCAATGTTTTAATGGCGGAT


Sequence: pTYB1.seq 	 Vector: pBS_KS+	No match

Sequence: pTYB1.seq 	 Vector: pLITMUS	No match

File: vector.fasta

>pBlueScript_from_84_to_204 KS+
tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca
tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag
c
>litmus.seq_from_62_to_182
tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca
tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag
c
>pTYB1.seq_from_59_to_179
tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca
tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag
c

Two types of output file are produced:

  1. The sequence file(s) - contain the trimmed subsequence(s) produced by vectorstrip either all in one file, or in separate files if the command line flag -ossingle is used.
  2. Results summary file

Data files

None.

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages 

  1. No suitable vectors found - exiting
    indicates that the 5' and 3' patterns for the vectors were blank - usually this is as a result of an empty vectorfile. 
  2. Illegal pattern
    indicates that one of the vector patterns could not be compiled and therefore cannot be searched. 
  3. 5' and 3' sequence matches are identical; inconclusive
    indicates that the 5' and 3' patterns provided were identical, and that they only match the sequence once. Thus the program cannot determine which part of the sequence is vector and which is insert.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program nameDescription
biosed Replace or delete sequence sections
codcopy Reads and writes a codon usage table
cutseq Removes a specified section from a sequence
degapseq Removes gap characters from sequences
descseq Alter the name or description of a sequence
entret Reads and writes (returns) flatfile entries
extractalign Extract regions from a sequence alignment
extractfeat Extract features from a sequence
extractseq Extract regions from a sequence
listor Write a list file of the logical OR of two sets of sequences
makenucseq Creates random nucleotide sequences
makeprotseq Creates random protein sequences
maskfeat Mask off features of a sequence
maskseq Mask off regions of a sequence
newseq Type in a short new sequence
noreturn Removes carriage return from ASCII files
notseq Exclude a set of sequences and write out the remaining ones
nthseq Writes one sequence from a multiple set of sequences
pasteseq Insert one sequence into another
revseq Reverse and complement a sequence
seqret Reads and writes (returns) sequences
seqretsplit Reads and writes (returns) sequences in individual files
skipseq Reads and writes (returns) sequences, skipping first few
splitter Split a sequence into (overlapping) smaller sequences
trimest Trim poly-A tails off EST sequences
trimseq Trim ambiguous bits off the ends of sequences
union Reads sequence fragments and builds one sequence
yank Reads a sequence range, appends the full USA to a list file

Author(s)