descseq

 

Function

Alter the name or description of a sequence

Description

Most sequence formats allow, at the very minimum, a name for the sequence and some comments to be stored in the sequence file.

Rather than using an editor to alter the name or the comments, descseq allows you to simply change them and write out a new file with the changes in and the sequence left unaltered.

The default action is to replace the existing name or description with your new one, but by using the qualifier '-append' what you enter is appended to the existing name or description.

Note that if you append to a description, no space is inserted by default bewteen the existing description and your appended text. You have to put in a space yourself if you require one.

Usage

Here is a sample session with descseq

Set the name of a sequence to "myclone23" 


% descseq -seq dna.text -out clone23.seq -name "myclone23" 
Alter the name or description of a sequence.

Go to the input files for this example
Go to the output files for this example

Example 2

Set the description of a sequence to "This is my clone number 244" 


% descseq -seq dna.text -out xy24.seq -desc "This is my clone number 244" 
Alter the name or description of a sequence.

Go to the output files for this example

Example 3

Append some text to the description of a sequence 


% descseq -seq dna.text -out est4.seq -desc " (submitted)" -append 
Alter the name or description of a sequence.

Go to the output files for this example

Command line arguments 

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   (Gapped) sequence filename and optional
                                  format, or reference (input USA)
  [-outseq]            seqout     [.] Sequence filename and
                                  optional format (output USA)

   Additional (Optional) qualifiers:
   -name               string     Name of the sequence (Any string is
                                  accepted)
   -description        string     Description of the sequence (Any string is
                                  accepted)

   Advanced (Unprompted) qualifiers:
   -append             boolean    [N] This allows you to append the name or
                                  description you have given on to the end of
                                  the existing name or description of the
                                  sequence.

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Standard (Mandatory) qualifiers Allowed values Default
[-sequence]
(Parameter 1)		 (Gapped) sequence filename and optional format, or reference (input USA) Readable sequence Required
[-outseq]
(Parameter 2)		 Sequence filename and optional format (output USA) Writeable sequence <*>.format
Additional (Optional) qualifiers Allowed values Default
-name Name of the sequence Any string is accepted An empty string is accepted
-description Description of the sequence Any string is accepted An empty string is accepted
Advanced (Unprompted) qualifiers Allowed values Default
-append This allows you to append the name or description you have given on to the end of the existing name or description of the sequence. Boolean value Yes/No No

Input file format

descseq reads a normal sequence USA.

Input files for usage example

File: dna.text

ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC
GTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

Output file format

descseq writes the sequence file with a changed name or description.

Output files for usage example

File: clone23.seq

>myclone23
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

Output files for usage example 2

File: xy24.seq

>EMBOSS_001 This is my clone number 244
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

Output files for usage example 3

File: est4.seq

>EMBOSS_001  (submitted)
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

Data files

None.

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None noted.

See also

Program nameDescription
biosed Replace or delete sequence sections
codcopy Reads and writes a codon usage table
cutseq Removes a specified section from a sequence
degapseq Removes gap characters from sequences
entret Reads and writes (returns) flatfile entries
extractalign Extract regions from a sequence alignment
extractfeat Extract features from a sequence
extractseq Extract regions from a sequence
listor Write a list file of the logical OR of two sets of sequences
makenucseq Creates random nucleotide sequences
makeprotseq Creates random protein sequences
maskfeat Mask off features of a sequence
maskseq Mask off regions of a sequence
newseq Type in a short new sequence
noreturn Removes carriage return from ASCII files
notseq Exclude a set of sequences and write out the remaining ones
nthseq Writes one sequence from a multiple set of sequences
pasteseq Insert one sequence into another
revseq Reverse and complement a sequence
seqret Reads and writes (returns) sequences
seqretsplit Reads and writes (returns) sequences in individual files
skipseq Reads and writes (returns) sequences, skipping first few
splitter Split a sequence into (overlapping) smaller sequences
trimest Trim poly-A tails off EST sequences
trimseq Trim ambiguous bits off the ends of sequences
union Reads sequence fragments and builds one sequence
vectorstrip Strips out DNA between a pair of vector sequences
yank Reads a sequence range, appends the full USA to a list file

Author(s)

Gary Williams (gwilliam © rfcgr.mrc.ac.uk)
MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None