union

 

Function

Reads sequence fragments and builds one sequence

Description

union reads in several sequences, concatenates them and writes them out as a single sequence.

It is most useful when the input sequences are specified in a List file. The List file (file of sequence names) can be any set of sequences in files or database entries specified in the normal EMBOSS USA (which can include the spcification of sub-regions of the sequence, eg. 'em:hsfau[20,55]'). Specifying several such subregions in a sequence or sequences allows you to enter disjoint sequences to be joined.

Usage

Here is a sample session with union

The file 'cds.list' contains a list of the regions making up the coding sequence of 'embl:x65923': 


% union 
Reads sequence fragments and builds one sequence
Input (gapped) sequence(s): @cds.list
output sequence [x65921.fasta]:

Go to the input files for this example
Go to the output files for this example

Command line arguments 

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     (Gapped) sequence(s) filename and optional
                                  format, or reference (input USA)
  [-outseq]            seqout     [.] Sequence filename and
                                  optional format (output USA)

   Additional (Optional) qualifiers:
   -overlapfile        outfile    [*.union] Sequence overlaps output file
                                  (optional)

   Advanced (Unprompted) qualifiers:
   -feature            boolean    [N] Use feature information
   -source             boolean    [N] Create source features
   -findoverlap        boolean    [N] Look for overlaps when joining

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   "-overlapfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Standard (Mandatory) qualifiers Allowed values Default
[-sequence]
(Parameter 1)		 (Gapped) sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
[-outseq]
(Parameter 2)		 Sequence filename and optional format (output USA) Writeable sequence <*>.format
Additional (Optional) qualifiers Allowed values Default
-overlapfile Sequence overlaps output file (optional) Output file <*>.union
Advanced (Unprompted) qualifiers Allowed values Default
-feature Use feature information Boolean value Yes/No No
-source Create source features Boolean value Yes/No No
-findoverlap Look for overlaps when joining Boolean value Yes/No No

Input file format

The input can be any set of sequences in a file of multiple sequence entries or in a List file. The sequences are concatenated in the order in which they appear in the file.

Input files for usage example

File: cds.list

tembl-id:X65921[782:856]
tembl-id:X65921[951:1095]
tembl-id:X65921[1557:1612]
tembl-id:X65921[1787:1912]

You may find the program yank useful for creating List files.

Output file format

Output files for usage example

File: x65921.fasta

>X65921 X65921.1 H.sapiens fau 1 gene
atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg
gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc
gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag
gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctg
gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag
aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg
cccacctttggcaagaagaagggccccaatgccaactcttaa

The result is a normal sequence file containing a single sequence resulting from the concatenation of the input sequences.

Data files

None.

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program nameDescription
biosed Replace or delete sequence sections
codcopy Reads and writes a codon usage table
cutseq Removes a specified section from a sequence
degapseq Removes gap characters from sequences
descseq Alter the name or description of a sequence
entret Reads and writes (returns) flatfile entries
extractalign Extract regions from a sequence alignment
extractfeat Extract features from a sequence
extractseq Extract regions from a sequence
listor Write a list file of the logical OR of two sets of sequences
makenucseq Creates random nucleotide sequences
makeprotseq Creates random protein sequences
maskfeat Mask off features of a sequence
maskseq Mask off regions of a sequence
newseq Type in a short new sequence
noreturn Removes carriage return from ASCII files
notseq Exclude a set of sequences and write out the remaining ones
nthseq Writes one sequence from a multiple set of sequences
pasteseq Insert one sequence into another
revseq Reverse and complement a sequence
seqret Reads and writes (returns) sequences
seqretsplit Reads and writes (returns) sequences in individual files
skipseq Reads and writes (returns) sequences, skipping first few
splitter Split a sequence into (overlapping) smaller sequences
trimest Trim poly-A tails off EST sequences
trimseq Trim ambiguous bits off the ends of sequences
vectorstrip Strips out DNA between a pair of vector sequences
yank Reads a sequence range, appends the full USA to a list file

You may find the program yank useful for creating List files.

Author(s)

Peter Rice (pmr © ebi.ac.uk)
Informatics Division, European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

History

Written (March 2002) - Peter Rice.

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None