![]() |
stssearch |
stssearchs reads in one or more sequences to be searched. For each pair of primers, it looks for matches between a the primers and the query sequence in either orientation.
Any matches found will be reported. Only one primer need match for it to be reported..
% stssearch Search a DNA database for matches with a set of STS primers Input nucleotide sequence(s): @eclac.list Primer pairs file: lac.primers Output file [j01636.stssearch]: |
Go to the input files for this example
Go to the output files for this example
Standard (Mandatory) qualifiers: [-seqall] seqall Nucleotide sequence(s) filename and optional format, or reference (input USA) [-infile] infile Primer pairs file [-outfile] outfile [*.stssearch] Output file name Additional (Optional) qualifiers: (none) Advanced (Unprompted) qualifiers: (none) Associated qualifiers: "-seqall" associated qualifiers -sbegin1 integer Start of each sequence to be used -send1 integer End of each sequence to be used -sreverse1 boolean Reverse (if DNA) -sask1 boolean Ask for begin/end/reverse -snucleotide1 boolean Sequence is nucleotide -sprotein1 boolean Sequence is protein -slower1 boolean Make lower case -supper1 boolean Make upper case -sformat1 string Input sequence format -sdbname1 string Database name -sid1 string Entryname -ufo1 string UFO features -fformat1 string Features format -fopenfile1 string Features file name "-outfile" associated qualifiers -odirectory3 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write standard output -filter boolean Read standard input, write standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages |
Standard (Mandatory) qualifiers | Allowed values | Default | |
---|---|---|---|
[-seqall] (Parameter 1) |
Nucleotide sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
[-infile] (Parameter 2) |
Primer pairs file | Input file | Required |
[-outfile] (Parameter 3) |
Output file name | Output file | <*>.stssearch |
Additional (Optional) qualifiers | Allowed values | Default | |
(none) | |||
Advanced (Unprompted) qualifiers | Allowed values | Default | |
(none) |
#Formerly ECLAC tembl:J01636 #Formerly ECLACA tembl:X51872 #Formerly ECLACI tembl:V00294 #Formerly ECLACY tembl:V00295 #Formerly ECLACZ tembl:V00296 |
PrimA ACCAGACACCCATCAACAG TATTTATGCCAGCCAGCCAG PrimB CGAAAGAATAAGAGCAGGCAAG GTAAGAGAAATAGACAGGCGG PrimC CGTCAGTATCCCCGTTTACAG TATCGCCAAAATCACCGCC PrimD AATACGCAAACCGCCTCTCC TTATCCGCTCACAATTCCACAC PrimE AATACGCAAACCGCCTCTCC CACAACCCGCTCACAATTCCA |
The primers file consists of three columns separated by tabs or spaces.
The first column is the name of the primer pair.
The second column is the sequence of the first primer.
The third column is the sequence of the second primer.
J01636: PrimA PrimerA matched at 532 J01636: (rev) PrimA PrimerB matched at 689 J01636: PrimB PrimerA matched at 5743 J01636: (rev) PrimB PrimerB matched at 5942 J01636: PrimC PrimerA matched at 2954 J01636: (rev) PrimC PrimerB matched at 3069 J01636: PrimD PrimerA matched at 1074 J01636: (rev) PrimD PrimerB matched at 1261 J01636: PrimE PrimerA matched at 1074 X51872: PrimB PrimerA matched at 98 X51872: (rev) PrimB PrimerB matched at 297 V00294: PrimA PrimerA matched at 484 V00294: (rev) PrimA PrimerB matched at 641 V00294: PrimD PrimerA matched at 1026 V00294: PrimE PrimerA matched at 1026 V00295: PrimB PrimerA matched at 1439 V00296: PrimC PrimerA matched at 1668 V00296: (rev) PrimC PrimerB matched at 1783 |
The output file consists of one line per match. This consists of:
Program name | Description |
---|---|
eprimer3 | Picks PCR primers and hybridization oligos |
primersearch | Searches DNA sequences for matches with primer pairs |
If you want something that only reports matches of both primer pairs and can find mismatches, use primersearch.