showorf

 

Function

Pretty output of DNA translations

Description

Showorf displays a nucleic acid sequence with its protein translation in a style suitable for publication. The translation can be done in any frame or combination of frames.

It uses codon frequency files to do the translation. You can specify the codon frequency file that you use with the '-cfile' option. The default table is 'Ehum.cut'.

Usage

Here is a sample session with showorf


% showorf 
Pretty output of DNA translations
Input nucleotide sequence: tembl:x13776
Select Frames To Translate
         0 : None
         1 : F1
         2 : F2
         3 : F3
         4 : R1
         5 : R2
         6 : R3
Select one or more values [1,2,3,4,5,6]: 
Output file [x13776.showorf]: 

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
   -frames             menu       [1,2,3,4,5,6] Select one or more values
                                  (Values: 0 (None); 1 (F1); 2 (F2); 3 (F3); 4
                                  (R1); 5 (R2); 6 (R3))
  [-outfile]           outfile    [*.showorf] Output file name

   Additional (Optional) qualifiers:
   -table              menu       [0] Genetic code to use (Values: 0
                                  (Standard); 1 (Standard (with alternative
                                  initiation codons)); 2 (Vertebrate
                                  Mitochondrial); 3 (Yeast Mitochondrial); 4
                                  (Mold, Protozoan, Coelenterate Mitochondrial
                                  and Mycoplasma/Spiroplasma); 5
                                  (Invertebrate Mitochondrial); 6 (Ciliate
                                  Macronuclear and Dasycladacean); 9
                                  (Echinoderm Mitochondrial); 10 (Euplotid
                                  Nuclear); 11 (Bacterial); 12 (Alternative
                                  Yeast Nuclear); 13 (Ascidian Mitochondrial);
                                  14 (Flatworm Mitochondrial); 15
                                  (Blepharisma Macronuclear); 16
                                  (Chlorophycean Mitochondrial); 21 (Trematode
                                  Mitochondrial); 22 (Scenedesmus obliquus);
                                  23 (Thraustochytrium Mitochondrial))
   -[no]ruler          boolean    [Y] Add a ruler
   -[no]plabel         boolean    [Y] Number translations
   -[no]nlabel         boolean    [Y] Number DNA sequence

   Advanced (Unprompted) qualifiers:
   -width              integer    [50] Width of screen (Integer 10 or more)

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Standard (Mandatory) qualifiers Allowed values Default
[-sequence]
(Parameter 1)
Nucleotide sequence filename and optional format, or reference (input USA) Readable sequence Required
-frames Select one or more values
0 (None)
1 (F1)
2 (F2)
3 (F3)
4 (R1)
5 (R2)
6 (R3)
1,2,3,4,5,6
[-outfile]
(Parameter 2)
Output file name Output file <*>.showorf
Additional (Optional) qualifiers Allowed values Default
-table Genetic code to use
0 (Standard)
1 (Standard (with alternative initiation codons))
2 (Vertebrate Mitochondrial)
3 (Yeast Mitochondrial)
4 (Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma)
5 (Invertebrate Mitochondrial)
6 (Ciliate Macronuclear and Dasycladacean)
9 (Echinoderm Mitochondrial)
10 (Euplotid Nuclear)
11 (Bacterial)
12 (Alternative Yeast Nuclear)
13 (Ascidian Mitochondrial)
14 (Flatworm Mitochondrial)
15 (Blepharisma Macronuclear)
16 (Chlorophycean Mitochondrial)
21 (Trematode Mitochondrial)
22 (Scenedesmus obliquus)
23 (Thraustochytrium Mitochondrial)
0
-[no]ruler Add a ruler Boolean value Yes/No Yes
-[no]plabel Number translations Boolean value Yes/No Yes
-[no]nlabel Number DNA sequence Boolean value Yes/No Yes
Advanced (Unprompted) qualifiers Allowed values Default
-width Width of screen Integer 10 or more 50

Input file format

showorf reads a normal nucleic acid sequence USA.

Input files for usage example

'tembl:x13776' is a sequence entry in the example nucleic acid database 'tembl'

Database entry: tembl:x13776

ID   X13776; SV 1; linear; genomic DNA; STD; PRO; 2167 BP.
XX
AC   X13776; M43175;
XX
DT   19-APR-1989 (Rel. 19, Created)
DT   14-NOV-2006 (Rel. 89, Last updated, Version 24)
XX
DE   Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
XX
KW   aliphatic amidase regulator; amiC gene; amiR gene.
XX
OS   Pseudomonas aeruginosa
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales;
OC   Pseudomonadaceae; Pseudomonas.
XX
RN   [1]
RP   1167-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
RN   [2]
RP   1167-2167
RX   DOI; 10.1016/0014-5793(89)80249-2.
RX   PUBMED; 2495988.
RA   Lowe N., Rice P.M., Drew R.E.;
RT   "Nucleotide sequence of the aliphatic amidase regulator gene of Pseudomonas
RT   aeruginosa";
RL   FEBS Lett. 246(1-2):39-43(1989).
XX
RN   [3]
RP   1-1292
RX   PUBMED; 1907262.
RA   Wilson S., Drew R.;
RT   "Cloning and DNA seqence of amiC, a new gene regulating expression of the
RT   Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC
RT   product.";
RL   J. Bacteriol. 173(16):4914-4921(1991).
XX
RN   [4]
RP   1-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
DR   GOA; Q51417.
DR   UniProtKB/Swiss-Prot; Q51417; AMIS_PSEAE.
XX


  [Part of this file has been deleted for brevity]

FT                   /replace=""
FT                   /note="ClaI fragment deleted in pSW36,  constitutive
FT                   phenotype"
FT   misc_feature    1
FT                   /note="last base of an XhoI site"
FT   misc_feature    648..653
FT                   /note="end of 658bp XhoI fragment, deletion in  pSW3 causes
FT                   constitutive expression of amiE"
FT   conflict        1281
FT                   /replace="g"
FT                   /citation=[3]
XX
SQ   Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;
     ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat        60
     ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac       120
     aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg       180
     aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg       240
     agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc       300
     ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg       360
     tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg       420
     agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga       480
     acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga       540
     ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa       600
     gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct       660
     acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg       720
     cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg       780
     ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg       840
     aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt       900
     acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct       960
     tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc      1020
     tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt      1080
     acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca      1140
     gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc      1200
     agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt      1260
     ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg      1320
     cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca      1380
     gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt      1440
     gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc      1500
     gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc      1560
     cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga      1620
     tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa      1680
     gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca      1740
     ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct      1800
     gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg      1860
     aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt      1920
     catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg      1980
     gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct      2040
     gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa      2100
     ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt      2160
     cctcgag                                                                2167
//

Output file format

As a sequence with high GC content (from Pseudmonas aeruginosa) PAAMIR has several overlapping open reading frames.

The true ORFs are 1..109 (amiB partial) 135..1292 (amiC) 1289..1879 (amiR) 1925..end (amiS partial)

Output files for usage example

File: x13776.showorf

SHOWORF of X13776 from 1 to 2167

           ---------|---------|---------|---------|---------|
         1 ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacggga 50
F1       1 G  T  A  G  R  A  S  A  R  S  P  P  A  G  R  R  E  17
F2       1  V  P  L  A  E  H  L  L  D  H  H  Q  P  G  D  G  N 17
F3       1   Y  R  W  P  S  I  C  S  I  T  T  S  R  A  T  G   16
R1       9   T  G  S  A  S  C  R  S  S  *  W  W  G  P  S  P   5
R2     106    Y  R  Q  G  L  M  Q  E  I  V  V  L  R  A  V  P  91
R3      38     V  A  P  R  A  D  A  R  D  G  G  A  P  R  R  S 23

           ---------|---------|---------|---------|---------|
        51 actgcacgatctacctggcgagcctggagcacgagcgggttcgcttcgta 100
F1      18  L  H  D  L  P  G  E  P  G  A  R  A  G  S  L  R  T 34
F2      18   C  T  I  Y  L  A  S  L  E  H  E  R  V  R  F  V   33
F3      17 T  A  R  S  T  W  R  A  W  S  T  S  G  F  A  S  Y  33
R1       4 F  Q  V  I  *  R  A  L  R  S  C  S  R  T  R  K  T  31
R2      90  V  A  R  D  V  Q  R  A  Q  L  V  L  P  N  A  E  Y 74
R3      22   S  C  S  R  G  P  S  G  P  A  R  A  P  E  S  R   7

           ---------|---------|---------|---------|---------|
       101 cggcgctgagcgacagtcacaggagaggaaacggatgggatcgcaccagg 150
F1      35   A  L  S  D  S  H  R  R  G  N  G  W  D  R  T  R   50
F2      34 R  R  *  A  T  V  T  G  E  E  T  D  G  I  A  P  G  14
F3      34  G  A  E  R  Q  S  Q  E  R  K  R  M  G  S  H  Q  E 50
R1      30  R  R  Q  A  V  T  V  P  S  S  V  S  P  I  A  G  P 14
R2      73   P  A  S  R  C  D  C  S  L  F  R  I  P  D  C  W   58
R3       6 V  A  S  L  S  L  *  L  L  P  F  P  H  S  R  V  L  398

           ---------|---------|---------|---------|---------|
       151 agcggccgctgatcggcctgctgttctccgaaaccggcgtcaccgccgat 200
F1      51 S  G  R  *  S  A  C  C  S  P  K  P  A  S  P  P  I  13
F2      15  A  A  A  D  R  P  A  V  L  R  N  R  R  H  R  R  Y 31
F3      51   R  P  L  I  G  L  L  F  S  E  T  G  V  T  A  D   66
R1      13   A  A  A  S  R  G  A  T  R  R  F  R  R  *  R  R   49
R2      57 S  R  G  S  I  P  R  S  N  E  S  V  P  T  V  A  S  41
R3     397  L  P  R  Q  D  A  Q  Q  E  G  F  G  A  D  G  G  I 381

           ---------|---------|---------|---------|---------|
       201 atcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagcaactgaa 250
F1      14  S  S  A  R  T  R  M  A  H  C  S  R  S  S  N  *  T 1
F2      32   R  A  L  A  R  V  W  R  I  A  R  G  R  A  T  E   47
F3      67 I  E  R  S  H  A  Y  G  A  L  L  A  V  E  Q  L  N  83
R1      48 Y  R  A  S  A  R  T  H  R  M  A  R  P  R  A  V  S  32
R2      40  I  S  R  E  C  A  Y  P  A  N  S  A  T  S  C  S  F 24
R3     380   D  L  A  R  V  R  I  A  C  Q  E  R  D  L  L  Q   365

           ---------|---------|---------|---------|---------|
       251 ccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc 300
F1       2   A  R  A  A  S  A  V  A  R  S  K  R  C  P  R  T   17


  [Part of this file has been deleted for brevity]

F2       8 N  N  K  R  G  I  V  I  M  L  G  L  V  L  L  Y  V  24
F3      22  I  T  R  G  V  S  S  S  C  W  D  W  F  C  C  T  L 38
R1      53  L  L  L  L  P  I  T  M  M  S  P  S  T  R  S  Y  T 37
R2      73   I  V  L  P  T  D  D  D  H  Q  S  Q  N  Q  Q  V   58
R3       7 C  Y  C  S  P  Y  R  *  *  A  P  V  P  E  A  T  R  7

           ---------|---------|---------|---------|---------|
      1951 tggcgcggtgctgtttctcaatgccgtctggttgctgggcaagatcagcg 2000
F1      16 W  R  G  A  V  S  Q  C  R  L  V  A  G  Q  D  Q  R  32
F2      25  G  A  V  L  F  L  N  A  V  W  L  L  G  K  I  S  G 41
F3      39   A  R  C  C  F  S  M  P  S  G  C  W  A  R  S  A   54
R1      36   P  A  T  S  N  R  L  A  T  Q  N  S  P  L  I  L   21
R2      57 N  A  R  H  Q  K  E  I  G  D  P  Q  Q  A  L  D  A  41
R3       6  Q  R  P  A  T  E  *  H  R  R  T  A  P  C  S  *  R 7

           ---------|---------|---------|---------|---------|
      2001 gtcgggaggtggcggtgatcaacttcctggtcggcgtgctgagcgcctgc 2050
F1      33  S  G  G  G  G  D  Q  L  P  G  R  R  A  E  R  L  R 49
F2      42   R  E  V  A  V  I  N  F  L  V  G  V  L  S  A  C   57
F3      55 V  G  R  W  R  *  S  T  S  W  S  A  C  *  A  P  A  3
R1      20 P  R  S  T  A  T  I  L  K  R  T  P  T  S  L  A  Q  4
R2      40  T  P  L  H  R  H  D  V  E  Q  D  A  H  Q  A  G  A 24
R3       6   D  P  P  P  P  S  *  S  G  P  R  R  A  S  R  R   28

           ---------|---------|---------|---------|---------|
      2051 gtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaa 2100
F1      50   R  V  L  P  D  L  F  R  S  S  R  A  G  L  A  E   65
F2      58 V  A  F  Y  L  I  F  S  A  A  A  G  Q  G  S  L  K  74
F3       4  S  R  S  T  *  S  F  P  Q  Q  P  G  R  A  R  *  R 1
R1       3  T  A  N  *  R  I  K  E  A  A  A  P  C  P  E  S  F 12
R2      23   D  R  E  V  Q  D  K  G  C  C  G  P  L  A  R  Q   8
R3      27 R  R  T  R  G  S  R  K  R  L  L  R  A  P  S  A  S  11

           ---------|---------|---------|---------|---------|
      2101 ggccggagcgctgaccctgctattcgcttttacctatctgtgggtggccg 2150
F1      66 G  R  S  A  D  P  A  I  R  F  Y  L  S  V  G  G  R  82
F2      75  A  G  A  L  T  L  L  F  A  F  T  Y  L  W  V  A  A 91
F3       2   P  E  R  *  P  C  Y  S  L  L  P  I  C  G  W  P   12
R1      11   A  P  A  S  V  R  S  N  A  K  V  *  R  H  T  A   7
R2       7 L  G  S  R  Q  G  Q  *  E  S  K  G  I  Q  P  H  G  7
R3      10  P  R  L  A  S  G  A  I  R  K  *  R  D  T  P  P  R 6

           ---------|-------
      2151 ccaaccagttcctcgag 2167
F1      83  Q  P  V  P  R    87
F2      92   N  Q  F  L  E   96
F3      13 P  T  S  S  S     17
R1       6 A  L  W  N  R  S  1
R2       6  G  V  L  E  E  L 1
R3       5   W  G  T  G  R   1

Data files

Showorf uses the codon frequency files to translate the sequence.

The codon usage table is read by default from "Ehum.cut" in the 'data/CODONS' directory of the EMBOSS distribution. If the name of a codon usage file is specified on the command line with the '-cfile' option, then this file will first be searched for in the current directory and then in the 'data/CODONS' directory of the EMBOSS distribution.

To see the available EMBOSS codon usage files, run:


% embossdata -showall

To fetch one of the codon usage tables (for example 'Emus.cut') into your current directory for you to inspect or modify, run:


% embossdata -fetch -file Emus.cut

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It exits with a status of 0. It always exits with status 0.

Known bugs

None.

See also

Program nameDescription
backtranambig Back translate a protein sequence to ambiguous codons
backtranseq Back translate a protein sequence
coderet Extract CDS, mRNA and translations from feature tables
getorf Finds and extracts open reading frames (ORFs)
marscan Finds MAR/SAR sites in nucleic sequences
plotorf Plot potential open reading frames
prettyseq Output sequence with translated ranges
remap Display sequence with restriction sites, translation etc
showseq Display a sequence with features, translation etc
sixpack Display a DNA sequence with 6-frame translation and ORFs
syco Synonymous codon usage Gribskov statistic plot
tcode Fickett TESTCODE statistic to identify protein-coding DNA
transeq Translate nucleic acid sequences
wobble Wobble base plot

Author(s)

Alan Bleasby (ajb © ebi.ac.uk)
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

History

1999 - written - Alan Bleasby

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None