EMBOSS: fuzznuc

fuzznuc

Function

Nucleic acid pattern search

Description

fuzznuc uses PROSITE style patterns to search nucleotide sequences.

Patterns are specifications of a (typically short) length of sequence to be found. They can specify a search for an exact sequence or they can allow various ambiguities, matches to variable lengths of sequence and repeated subsections of the sequence.

fuzznuc intelligently selects the optimum searching algorithm to use, depending on the complexity of the search pattern specified.

Usage

Here is a sample session with fuzznuc

% fuzznuc Nucleic acid pattern search Input nucleotide sequence(s): tembl:L46634 Search pattern: AAGCTT Output report [l46634.fuzznuc]:

Go to the input files for this example
Go to the output files for this example

Example 2

% fuzznuc Nucleic acid pattern search Input nucleotide sequence(s): tembl:L46634 Search pattern: @nucseq.pat Output report [l46634.fuzznuc]:

Go to the input files for this example
Go to the output files for this example

Example 3

% fuzznuc -pname test Nucleic acid pattern search Input nucleotide sequence(s): tembl:L46634 Search pattern: @nucsimple.pat Output report [l46634.fuzznuc]:

Go to the input files for this example
Go to the output files for this example

Example 4

% fuzznuc Nucleic acid pattern search Input nucleotide sequence(s): tembl:L46634 Search pattern: @nuc.pat Output report [l46634.fuzznuc]:

Go to the input files for this example
Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Nucleotide sequence(s) filename and optional
                                  format, or reference (input USA)
   -pattern            pattern    The standard IUPAC one-letter codes for the
                                  nucleotides are used.
                                  The symbol 'n' is used for a position where
                                  any nucleotide is accepted.
                                  Ambiguities are indicated by listing the
                                  acceptable nucleotides for a given position,
                                  between square parentheses '[ ]'. For
                                  example: [ACG] stands for A or C or G.
                                  Ambiguities are also indicated by listing
                                  between a pair of curly brackets '{ }' the
                                  nucleotides that are not accepted at a given
                                  position. For example: {AG} stands for any
                                  nucleotides except A and G.
                                  Each element in a pattern is separated from
                                  its neighbor by a '-'. (Optional in
                                  fuzznuc).
                                  Repetition of an element of the pattern can
                                  be indicated by following that element with
                                  a numerical value or a numerical range
                                  between parenthesis. Examples: N(3)
                                  corresponds to N-N-N, N(2,4) corresponds to
                                  N-N or N-N-N or N-N-N-N.
                                  When a pattern is restricted to either the
                                  5' or 3' end of a sequence, that pattern
                                  either starts with a '<' symbol or
                                  respectively ends with a '>' symbol.
                                  A period ends the pattern. (Optional in
                                  fuzznuc).
                                  For example, [CG](5)TG{A}N(1,5)C
  [-outfile]           report     [*.fuzznuc] Output report file name

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -complement         boolean    [N] Search complementary strand

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-pattern" associated qualifiers
   -pformat            string     File format
   -pmismatch          integer    Pattern mismatch
   -pname              string     Pattern base name

   "-outfile" associated qualifiers
   -rformat2           string     Report format
   -rname2             string     Base file name
   -rextension2        string     File name extension
   -rdirectory2        string     Output directory
   -raccshow2          boolean    Show accession number in the report
   -rdesshow2          boolean    Show description in the report
   -rscoreshow2        boolean    Show the score in the report
   -rusashow2          boolean    Show the full USA in the report
   -rmaxall2           integer    Maximum total hits to report
   -rmaxseq2           integer    Maximum hits to report for one sequence

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Standard (Mandatory) qualifiers Allowed values Default

[-sequence]
(Parameter 1) Nucleotide sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required

-pattern The standard IUPAC one-letter codes for the nucleotides are used. The symbol 'n' is used for a position where any nucleotide is accepted. Ambiguities are indicated by listing the acceptable nucleotides for a given position, between square parentheses '[ ]'. For example: [ACG] stands for A or C or G. Ambiguities are also indicated by listing between a pair of curly brackets '{ }' the nucleotides that are not accepted at a given position. For example: {AG} stands for any nucleotides except A and G. Each element in a pattern is separated from its neighbor by a '-'. (Optional in fuzznuc). Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis. Examples: N(3) corresponds to N-N-N, N(2,4) corresponds to N-N or N-N-N or N-N-N-N. When a pattern is restricted to either the 5' or 3' end of a sequence, that pattern either starts with a '<' symbol or respectively ends with a '>' symbol. A period ends the pattern. (Optional in fuzznuc). For example, [CG](5)TG{A}N(1,5)C Property value(s)

[-outfile]
(Parameter 2) Output report file name Report output file <*>.fuzznuc

Additional (Optional) qualifiers Allowed values Default

(none)

Advanced (Unprompted) qualifiers Allowed values Default

-complement Search complementary strand Boolean value Yes/No No

Standard (Mandatory) qualifiers	Allowed values	Default
[-sequence] (Parameter 1)	Nucleotide sequence(s) filename and optional format, or reference (input USA)	Readable sequence(s)	Required
-pattern	The standard IUPAC one-letter codes for the nucleotides are used. The symbol 'n' is used for a position where any nucleotide is accepted. Ambiguities are indicated by listing the acceptable nucleotides for a given position, between square parentheses '[ ]'. For example: [ACG] stands for A or C or G. Ambiguities are also indicated by listing between a pair of curly brackets '{ }' the nucleotides that are not accepted at a given position. For example: {AG} stands for any nucleotides except A and G. Each element in a pattern is separated from its neighbor by a '-'. (Optional in fuzznuc). Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis. Examples: N(3) corresponds to N-N-N, N(2,4) corresponds to N-N or N-N-N or N-N-N-N. When a pattern is restricted to either the 5' or 3' end of a sequence, that pattern either starts with a '<' symbol or respectively ends with a '>' symbol. A period ends the pattern. (Optional in fuzznuc). For example, [CG](5)TG{A}N(1,5)C	Property value(s)
[-outfile] (Parameter 2)	Output report file name	Report output file	<>*.fuzznuc
Additional (Optional) qualifiers	Allowed values	Default
(none)
Advanced (Unprompted) qualifiers	Allowed values	Default
-complement	Search complementary strand	Boolean value Yes/No	No

Input file format

fuzznuc reads in normal nucleic acid sequence USAs.

Input files for usage example

'tembl:L46634' is a sequence entry in the example nucleic acid database 'tembl'

Database entry: tembl:L46634

ID   L46634; SV 1; linear; genomic DNA; STD; VRL; 1272 BP.
XX
AC   L46634; L46689;
XX
DT   06-NOV-1995 (Rel. 45, Created)
DT   04-MAR-2000 (Rel. 63, Last updated, Version 3)
XX
DE   Human herpesvirus 7 (clone ED132'1.2) telomeric repeat region.
XX
KW   telomeric repeat.
XX
OS   Human herpesvirus 7
OC   Viruses; dsDNA viruses, no RNA stage; Herpesviridae; Betaherpesvirinae;
OC   Roseolovirus.
XX
RN   [1]
RP   1-1272
RX   PUBMED; 7494318.
RA   Secchiero P., Nicholas J., Deng H., Xiaopeng T., van Loon N., Ruvolo V.R.,
RA   Berneman Z.N., Reitz M.S. Jr., Dewhurst S.;
RT   "Identification of human telomeric repeat motifs at the genome termini of
RT   human herpesvirus 7: structural analysis and heterogeneity";
RL   J. Virol. 69(12):8041-8045(1995).
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..1272
FT                   /organism="Human herpesvirus 7"
FT                   /strain="JI"
FT                   /mol_type="genomic DNA"
FT                   /clone="ED132'1.2"
FT                   /db_xref="taxon:10372"
FT   repeat_region   207..928
FT                   /note="long and complex repeat region composed of various
FT                   direct repeats, including TAACCC (TRS), degenerate copies
FT                   of TRS motifs and a 14-bp repeat, TAGGGCTGCGGCCC"
FT   misc_signal     938..998
FT                   /note="pac2 motif"
FT   misc_feature    1009
FT                   /note="right genome terminus (...ACA)"
XX
SQ   Sequence 1272 BP; 346 A; 455 C; 222 G; 249 T; 0 other;
     aagcttaaac tgaggtcaca cacgacttta attacggcaa cgcaacagct gtaagctgca        60
     ggaaagatac gatcgtaagc aaatgtagtc ctacaatcaa gcgaggttgt agacgttacc       120
     tacaatgaac tacacctcta agcataacct gtcgggcaca gtgagacacg cagccgtaaa       180
     ttcaaaactc aacccaaacc gaagtctaag tctcacccta atcgtaacag taaccctaca       240
     actctaatcc tagtccgtaa ccgtaacccc aatcctagcc cttagcccta accctagccc       300
     taaccctagc tctaacctta gctctaactc tgaccctagg cctaacccta agcctaaccc       360
     taaccgtagc tctaagttta accctaaccc taaccctaac catgaccctg accctaaccc       420
     tagggctgcg gccctaaccc tagccctaac cctaacccta atcctaatcc tagccctaac       480
     cctagggctg cggccctaac cctagcccta accctaaccc taaccctagg gctgcggccc       540
     taaccctaac cctagggctg cggcccgaac cctaacccta accctaaccc taaccctagg       600
     gctgcggccc taaccctaac cctagggctg cggccctaac cctaacccta gggctgcggc       660
     ccgaacccta accctaaccc taaccctagg gctgcggccc taaccctaac cctagggctg       720
     cggccctaac cctaacccta actctagggc tgcggcccta accctaaccc taaccctaac       780
     cctagggctg cggcccgaac cctagcccta accctaaccc tgaccctgac cctaacccta       840
     accctaaccc taaccctaac cctaacccta accctaaccc taaccctaac cctaacccta       900
     accctaaccc taaccctaac cctaaccccg cccccactgg cagccaatgt cttgtaatgc       960
     cttcaaggca ctttttctgc gagccgcgcg cagcactcag tgaaaaacaa gtttgtgcac      1020
     gagaaagacg ctgccaaacc gcagctgcag catgaaggct gagtgcacaa ttttggcttt      1080
     agtcccataa aggcgcggct tcccgtagag tagaaaaccg cagcgcggcg cacagagcga      1140
     aggcagcggc tttcagactg tttgccaagc gcagtctgca tcttaccaat gatgatcgca      1200
     agcaagaaaa atgttctttc ttagcatatg cgtggttaat cctgttgtgg tcatcactaa      1260
     gttttcaagc tt                                                          1272
//

Input files for usage example 2

File: nucseq.pat

>targetseq
cg(2)c(3)taac
cctagc(3)ta

Input files for usage example 3

File: nucsimple.pat

cg(2)c(3)taac
cctagc(3)ta

Input files for usage example 4

File: nuc.pat

>pat1
cggccctaaccctagcccta
>pat2 <mismatch=1>
cg(2)c(3)taac
cctagc(3)ta
>pat3
cggc(2,4)taac(2,5)

Pattern specification

Patterns for fuzznuc are based on the format of pattern used in the PROSITE database, with the difference that the terminating dot '.' and the hyphens, '-', between the characters are optional.

The PROSITE pattern definition from the PROSITE documentation (amended to refer to nucleic acid sequences, not proteins) follows.

The standard IUPAC one-letter codes for the nucleotides are used.
The symbol `n' is used for a position where any nucleotide is accepted.
Ambiguities are indicated by listing the acceptable nucleotides for a given position, between square parentheses `[ ]'. For example: [ACG] stands for A or C or G.
Ambiguities are also indicated by listing between a pair of curly brackets `{ }' the nucleotides that are not accepted at a given position. For example: {AG} stands for any nucleotides except A and G.
Each element in a pattern is separated from its neighbor by a `-'. (Optional in fuzznuc).
Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis. Examples: N(3) corresponds to N-N-N, N(2,4) corresponds to N-N or N-N-N or N-N-N-N.
When a pattern is restricted to either the 5' or 3' end of a sequence, that pattern either starts with a `<' symbol or respectively ends with a `>' symbol.
A period ends the pattern. (Optional in fuzznuc).
All other characters, including spaces are not allowed.

For example, in the EMBL entry ECLAC you can look for the pattern:


[CG](5)TG{A}N(1,5)C

This searches for "C or G" 5 times, followed by T and G, then anything except A, then any base (1 to 5 times) before a C.

You can use ambiguity codes for nucleic acid searches but not within [] or {} as they expand to bracketed counterparts. For example, "s" is expanded to "[GC]" therefore [S] would be expanded to [[GC]] which is illegal.

Note the use of X is reserved for proteins. You must use N for nucleic acids to refer to any base.

The search is case-independent, so 'AAA' matches 'aaa'.

Output file format

The output is a standard EMBOSS report file.

The results can be output in one of several styles by using the command-line qualifier -rformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, trace, listfile, dbmotif, diffseq, excel, feattable, motif, regions, seqtable, simple, srs, table, tagseq

See: http://emboss.sf.net/docs/themes/ReportFormats.html for further information on report formats.

By default fuzznuc writes a 'seqtable' report file.

Output files for usage example

File: l46634.fuzznuc

########################################
# Program: fuzznuc
# Rundate: Sun 15 Jul 2007 12:00:00
# Commandline: fuzznuc
#    -sequence tembl:L46634
#    -pattern AAGCTT
# Report_format: seqtable
# Report_file: l46634.fuzznuc
########################################

#=======================================
#
# Sequence: L46634     from: 1   to: 1272
# HitCount: 2
#
# Pattern_name Mismatch Pattern
# pattern1            0 AAGCTT
# 
# Complement: No
#
#=======================================

  Start     End Pattern_name Mismatch Sequence
      1       6 pattern1            . aagctt
   1267    1272 pattern1            . aagctt

#---------------------------------------
#---------------------------------------

#---------------------------------------
# Total_sequences: 1
# Total_hitcount: 2
#---------------------------------------

Output files for usage example 2

File: l46634.fuzznuc

########################################
# Program: fuzznuc
# Rundate: Sun 15 Jul 2007 12:00:00
# Commandline: fuzznuc
#    -sequence tembl:L46634
#    -pattern @../../data/nucseq.pat
# Report_format: seqtable
# Report_file: l46634.fuzznuc
########################################

#=======================================
#
# Sequence: L46634     from: 1   to: 1272
# HitCount: 2
#
# Pattern_name Mismatch Pattern
# targetseq           0 cg(2)c(3)taaccctagc(3)ta
# 
# Complement: No
#
#=======================================

  Start     End Pattern_name Mismatch Sequence
    429     448 targetseq           . cggccctaaccctagcccta
    491     510 targetseq           . cggccctaaccctagcccta

#---------------------------------------
#---------------------------------------

#---------------------------------------
# Total_sequences: 1
# Total_hitcount: 2
#---------------------------------------

Output files for usage example 3

File: l46634.fuzznuc

########################################
# Program: fuzznuc
# Rundate: Sun 15 Jul 2007 12:00:00
# Commandline: fuzznuc
#    -pname test
#    -sequence tembl:L46634
#    -pattern @../../data/nucsimple.pat
# Report_format: seqtable
# Report_file: l46634.fuzznuc
########################################

#=======================================
#
# Sequence: L46634     from: 1   to: 1272
# HitCount: 13
#
# Pattern_name Mismatch Pattern
# test1               0 cg(2)c(3)taac
# test2               0 cctagc(3)ta
# 
# Complement: No
#
#=======================================

  Start     End Pattern_name Mismatch Sequence
    429     438 test1               . cggccctaac
    491     500 test1               . cggccctaac
    535     544 test1               . cggccctaac
    605     614 test1               . cggccctaac
    631     640 test1               . cggccctaac
    695     704 test1               . cggccctaac
    721     730 test1               . cggccctaac
    753     762 test1               . cggccctaac
    293     302 test2               . cctagcccta
    439     448 test2               . cctagcccta
    469     478 test2               . cctagcccta
    501     510 test2               . cctagcccta
    801     810 test2               . cctagcccta

#---------------------------------------
#---------------------------------------

#---------------------------------------
# Total_sequences: 1
# Total_hitcount: 13
#---------------------------------------

Output files for usage example 4

File: l46634.fuzznuc

########################################
# Program: fuzznuc
# Rundate: Sun 15 Jul 2007 12:00:00
# Commandline: fuzznuc
#    -sequence tembl:L46634
#    -pattern @../../data/nuc.pat
# Report_format: seqtable
# Report_file: l46634.fuzznuc
########################################

#=======================================
#
# Sequence: L46634     from: 1   to: 1272
# HitCount: 19
#
# Pattern_name Mismatch Pattern
# pat1                0 cggccctaaccctagcccta
# pat2                1 cg(2)c(3)taaccctagc(3)ta
# pat3                0 cggc(2,4)taac(2,5)
# 
# Complement: No
#
#=======================================

  Start     End Pattern_name Mismatch Sequence
    429     448 pat1                . cggccctaaccctagcccta
    491     510 pat1                . cggccctaaccctagcccta
    429     448 pat2                . cggccctaaccctagcccta
    491     510 pat2                . cggccctaaccctagcccta
    535     554 pat2                1 cggccctaaccctaacccta
    605     624 pat2                1 cggccctaaccctaacccta
    631     650 pat2                1 cggccctaaccctaacccta
    695     714 pat2                1 cggccctaaccctaacccta
    721     740 pat2                1 cggccctaaccctaacccta
    753     772 pat2                1 cggccctaaccctaacccta
    791     810 pat2                1 cggcccgaaccctagcccta
    753     764 pat3                . cggccctaaccc
    721     732 pat3                . cggccctaaccc
    695     706 pat3                . cggccctaaccc
    631     642 pat3                . cggccctaaccc
    605     616 pat3                . cggccctaaccc
    535     546 pat3                . cggccctaaccc
    491     502 pat3                . cggccctaaccc
    429     440 pat3                . cggccctaaccc

#---------------------------------------
#---------------------------------------

#---------------------------------------
# Total_sequences: 1
# Total_hitcount: 19
#---------------------------------------

Data files

None.

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with a status of 0.

Known bugs

None.

Program name	Description
dreg	Regular expression search of a nucleotide sequence
fuzztran	Protein pattern search after translation
marscan	Finds MAR/SAR sites in nucleic sequences

Author(s)

Alan Bleasby (ajb © ebi.ac.uk)
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

History

Written (2000) - Alan Bleasby
'-usa' added (13 March 2001) - Gary Williams

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None

Function

Description

Usage

Command line arguments

Input file format

Input files for usage example

Database entry: tembl:L46634

Input files for usage example 2

File: nucseq.pat

Input files for usage example 3

File: nucsimple.pat

Input files for usage example 4

File: nuc.pat

Pattern specification

Output file format

Output files for usage example

File: l46634.fuzznuc

Output files for usage example 2

File: l46634.fuzznuc

Output files for usage example 3

File: l46634.fuzznuc

Output files for usage example 4

File: l46634.fuzznuc

Data files

Notes

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

Author(s)

History

Target users

Comments